CF834957

Overview
NameCF834957
Unique NameCF834957
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12881 contig Csv1_Contig12881:1224..1553. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_06G21_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06G21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834957 ID=CF834957|Name=CF834957|organism=Citrus sinensis|type=EST|length=330bp
GATAATCTCTTGTATAAGAGATTTTTGTAAGCCTTCTGAACTAAATTGAC
ACTCTTATAATTGATAGATAATAACTGTACCCATCTTATTATTTAATTAT
ATATATCATCATCCAGATTGCAGACACTTACCCATAATAATCAGGATTTC
TCCCATATTGAGGAATAACAATAAGATCAAGATTGTCATTCCCAACATCA
TCATCAGCAATACTGGAAGGGGGGAGTAAGTAACCTTCTGACGGATCGCT
CATACCTGCGCCAGGAAAAGTTTTCATATTCTTCAAGTCAGAAAACATAT
TTGCTAACTTCAAGTGCACTATATTAAAAA
back to top