CF835068

Overview
NameCF835068
Unique NameCF835068
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length452
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS02_06J21_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06J21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835068 ID=CF835068; Name=CF835068; organism=Citrus sinensis; type=EST; length=452bp
TTTTTTTTTTTTTTTTTGGAAGCAGGATCAAGGGAATTGGGGGACAATAA
TCCCACTCTAGAAATGTATTAATCCTTAAGCTGGAACAAATGATGCATAA
ACCGAGTATCTCTTTATTTCAACACGATTACAGGACCTTCATAGGCTAAC
TTAAACCTAAAACATCCCTTGAGTCCAGGAAAAAAAAAGAAAGTGAATGT
TAAAACAAAGAAAGAAGCCTTCTGCTGCCAATTCGAAGATCATTTAACAG
CATGTCCACCAAGCATATGCAAATTCACTTCTTGTGCCTCTGTACGAATG
GAGAATTCTTTGCGTCCTCCTCAGTTAAACCAAGAGAGAACTTAGTGATG
ATAGTGCCGGTGATGGCGAATCCCACCAGGAATGGCCAGTTCCGATTCCA
TTCTCTCCTGAAGAAGATCGGCCACGGGTCGAATTTTCTCATTTTTACGT
CC
back to top