CF835075

Overview
NameCF835075
Unique NameCF835075
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length445
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K01_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835075 ID=CF835075; Name=CF835075; organism=Citrus sinensis; type=EST; length=445bp
TTTTTTTTTTTTTGTTTTTTATAGAACCAATATGTTGACACACCCCTTAA
CTTTTATTGATTTATTTCCTTTTTCAGGAAAATACCTTTCTCAAAAGTAA
ACAAAAAGATTGCTTGTACGTCTCAAGAAATCTTATAATTTGAACTAAAC
CATACTAAAACATAGGCATGATTGATAGGTAATAGTATACCTATCATTTA
TTTAATTAAACAAAACAGAAAAAAAAAAAAGCAGGGCTGCACTTAACCCA
TGAAGTCGGGGTTTCTTCCATATTGGGGGACATTAAGAAAATCAAGATTG
TCGTTCATGACATCATCATCAGCAATACTGCCAAACGGAGGAAGCAGAAG
ACCCTCTAACCAGTTATTACCTGCGCAGGGGGTTTCCATGTTCTTCAAAT
CAGAAAGATCTCTGCTTACGGGAATCAAAGTTCGAATCTACTTAA
back to top