CF835076

Overview
NameCF835076
Unique NameCF835076
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length443
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K01_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835076 ID=CF835076; Name=CF835076; organism=Citrus sinensis; type=EST; length=443bp
CTTAACTACTTTCTAACTTTGATTCCCGTAAGCAGAGATCTTTCTGATTT
GAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTC
TGCTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAACGACAAT
CTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGG
TTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAA
TGATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTATGGTTT
AGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTAC
TTTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTAT
TGTGTGTGTCAACATATTGGTTCTATTAAAAAAAAAAAAAAAA
back to top