CF835087

Overview
NameCF835087
Unique NameCF835087
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length343
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K10_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835087 ID=CF835087; Name=CF835087; organism=Citrus sinensis; type=EST; length=343bp
AACCGATCAAAACTACACATCATAACCCAAGGAAAATATCAAAACACGGA
ACGGGAACATTGAACTCCTAATTTATCCTACAAAACCCTACTTCCTCCAG
CTACCGCCATCAGAAGCACCGCTCCTTGAGTATCGGGAACCACCATCACC
GCCATATCCACCGTCACGGCTGTAACCACCTTCACGGCGGCCACCATATC
CACCGCCGCCACCTCCGTATCCGCGGCTCCCACCGTATCCACCGCCACCA
CCACTTTCACGGGGACCACCACCTCCATATCCACCACCGCCACGGTTTCC
GTAACCGCCACCGCCACCGCCACCGCTTCCACAGGACTGGGCC
back to top