CF835088

Overview
NameCF835088
Unique NameCF835088
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length413
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K11_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835088 ID=CF835088; Name=CF835088; organism=Citrus sinensis; type=EST; length=413bp
TTAATATAGTGCACTCGAAGCTAGCAAAGATCTTTTCTGACTTGAAGAAT
ATGAAAACTCTTCCTGGCGCAGGTATGAGCGATCCGTCAGAAGGTTACTT
ACTCCCCCCTTCCAGTATTGCTGATGATGATGTTGGGAATGACAATCTTG
ATCTTATTGTTATTCCTCAATATGGGAGAAATCCTGATTATTATGGGTAA
GTGTCTACAATCTGGATGATGATATATATAATTAAATAAAAAGATGGGTA
CAGTTATTACCTATCAATTATAAGAGTGTCAATTTAGTTCAGTTCACTTA
CAAAAATCTCTTATACAAGAGATTATCTTTGTTTGCGTTCATGTACTTTG
TCTTCTTTAATTAATAAATAAAACTATTGTGTATCATTGTGTTGATTAAA
AAAAAAAAAAAAA
back to top