CF835092

Overview
NameCF835092
Unique NameCF835092
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length217
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K14_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835092 ID=CF835092; Name=CF835092; organism=Citrus sinensis; type=EST; length=217bp
TTTTTCAGGAGTTGTGAATTGAAATGACATCTTTACAGATAATAAGTTGA
GAAATACACATTGTTTGAAACCATCAAGTTTTACATATAAACACAACCAA
ATATGACCTACAACCTAGTGCCACAAAAAACCAACAAGGTTCAAATGAGC
TCAAATACAAATAGTAATAAAATATAATTATATATCTCTAGAACGCGAAA
ACAGTACTATCAAGCAG
back to top