CF835309

Overview
NameCF835309
Unique NameCF835309
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length737
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12847 contig Csv1_Contig12847:106..842. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01A11_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835309 ID=CF835309|Name=CF835309|organism=Citrus sinensis|type=EST|length=737bp
AGGCTCACTCTCTTAATTTAAAAAAAAAAATGGAAATAGAACCAACAAAA
CCACCAGTGGTAGCTAAGAAGCTATGGAAGATAGTACGTATAGTGTTCTT
CATGATAAAGGCAGGCATATCGAAGAGCAAAATAATGGTCGATTTTCATT
TGATGCTGAAGCGAGGCAACAAGCTCGCAGGTAAAGCCATAGGCAATCTC
ATATTCCACAACCACCTCTCTTCTTTAAGCTGCCGCTCTAACGACGCTCA
TCTCTCCTTCATCTCACCAAAAGAATACGAATTCAGCTGCAGCAATAGCC
CCGCTTTTAATTTTAGTTACCCTTTTACTAATTACGGCCACAACAAGCGC
AAACACCACCACTACCATTTGCAGAAGGCAGCCAAGGCTTATCACTATGA
TGATGTGGCCACGGTTCAGGCCGTGCAGAGGGTTCTTGAGATGTTAAATA
CTAGTGATAATAATCACGCAGTTGCCTCGGCGGCGCCTTCTCCGTTGGTT
ACGTTGCCTGGGTTTGGACGGAGCCCGTTGGTGAGGCAGTTGAGGATAAC
GGACTCGCCGTTCCCGTTGAAAGATGAAGGTGATGGCCAGGTAGATAAAG
CTGCTGAAGACTTCATTAAAAAGTTTTATAAAGACCTTATGTTGCAGAAA
TCAATGGCCGCCTTCGAATCACCGTACCACCACTCATGGGATCGATGACT
TTTACGCCTTTAATTGTACCATCAGTGGAGTTTTGAT
back to top