CF835314

Overview
NameCF835314
Unique NameCF835314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length361
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_01A14_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835314 ID=CF835314|Name=CF835314|organism=Citrus sinensis|type=EST|length=361bp
TTTTTTTTTTTTTTTTATCTGAAGCTCAGCTTTTATTTAATGCATTAATA
TATAAATACTAATGGAGGTAATTAAATAGTACCTGGCGGAGAAGCTCTTA
CTCCTTACCAACTCACAATACAGAGACATAACAGAATAAACAATGTATAG
AATACATAGCGGAAGGTAATGACTCCACATTCTTAATAATATTGTTATTT
TAAAAGTCCAACAACACAAGCACAAGATTAATACATGATATATATGCAAC
GTAAGTGCGTGCTTAGGCAGCTTTTGCTCCTAATTAATTGGCCTTGAGAA
TATAGTCATCCACTTCCTGAAAGTTCTTGAGTGCAAAGTCCTTGATGACG
CTTGGATCGGG
back to top