CF835315

Overview
NameCF835315
Unique NameCF835315
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length362
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_01A14_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835315 ID=CF835315|Name=CF835315|organism=Citrus sinensis|type=EST|length=362bp
TCCCGATCCAAGCCTCATCAAGGACTTTGCACTCAAGAACTTTCAGGAAG
TGGACGACTATATTCTCAAGGCCAATTAATTAGGAGCAAAAGCTGCCTAA
GCACGCACTTACGTTGCATATATATCATGTATTAATCTTGTGCTTGTGTT
GTTGGACTTTTAAAATAACAATATTATTAAGAATGTGGAGTCATTACCTT
CCGCTATGTATTCTATACATTGTTTATTCTGTTATGTCTCTGTATTGTGA
GTTGGTAAGGAGTAAGAGCTTCTCCGCCAGCTACTATTTAATTACCTCCA
TTAGTATTTATATATTGCTTCATTAAATAAAAGCTGAGCTTCAGATAAAA
AAAAAAAAAAAA
back to top