CF835322

Overview
NameCF835322
Unique NameCF835322
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length212
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF835322_ssr23 microsatellite CF835322_ssr23:23..34.
Properties
Property NameValue
Genbank descriptionUCRCS03_01A18_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835322 ID=CF835322|Name=CF835322|organism=Citrus sinensis|type=EST|length=212bp
AAAACATACATTACAACGCGCCTAATTAATTAATTAAGACCTGAACATGA
TCTTGATTTGCGAAATTAAACATATCCAGAGATGTCATATCATGTCGCAA
ACGTCCAATTTAAAAAAAATTAATTTTACTCAAATTTCATTACTGACCGA
AACCTTGCTCATTGAGCCCTTGCAATGAGCGATTGCACCTGGAATCACAC
TCTGCAACTCCT
back to top