CF835326

Overview
NameCF835326
Unique NameCF835326
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length638
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS03_01A21_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835326 ID=CF835326|Name=CF835326|organism=Citrus sinensis|type=EST|length=638bp
TTTTTTTTTTTTTTTTTCCATTCAAAAAAGCCAAAAGAGGGCAAACCCCA
ATTTTTGCCTTTCCAAGTTGAGCCCATTTTTATTATTAAAAAAAAAGAAA
CCCTTCCTCTCTTTTCCGTAAAAAGGGTTCTTATTTTACATTGGCTAAAA
TTGGAAAAAACAAAAAGGGGGGCTAACCCCAAAAGGACTATTATTTCAAA
TTAAAAAAAAACTAATCTTTTTTGCATGGGTTGCCCATTTCACCAAGGGA
AACGTCAGGCAATTTACCACAATCATAACCAGTAACTTTTTTGCCAAGTA
CCCCCCCAACAAGGAACCTATAAAAAATAACATCTCTCAAAAACCTCCTC
CACCAATTTGACCCCCCATCTTGTACCCATCCGGACAAATACGACCCTAT
AACCAGTCCTGTCACACCCCATTTTCTTTCCTTCACATATCCCTCGATAG
CTTGAGCAACATTTTTGTCTCCTGTTGGAACAATGGGCCCTTTGGTTTTA
ATTAAAAAATTACCAATGGGACGGCCAAGTACCACGGCGTCTTCTAGCGC
CTGACAGCCGCCTTGTCCAAAATCGGGAGTCATCGGGGGCATGGGGTCTC
CCGCCACCGGGACGTTTCCTTTACTCAAATTTCCAAAA
back to top