CF835327

Overview
NameCF835327
Unique NameCF835327
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length536
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12010 contig Csv1_Contig12010:23..558. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01A21_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835327 ID=CF835327|Name=CF835327|organism=Citrus sinensis|type=EST|length=536bp
GACCGATAGATCATGGAAACGGTAGAAAAAGATGTTGTAATAATTGGAGC
AGGGATAGCAGGATTGGCAACGGCGTTGGCTCTCAAGAGACTTGGAATTA
AACCCTTGGTTTTAGAAAAATCGGACGGGCTCCGAGGCACTGGTGCTGCG
ATAAATTTTGCCCCAAACGCTTGGCTTGCTCTTGATGCTCTTGGTGTTTC
TCACAAGCTTGCTTCCATTTATGATCCTGTTAAGAGGTTGTTTGTAACAA
ATCTTAGAACTGGAGCAACTCAAGAGACGTCCTTAGCTGGAAAATCTGAG
AATGGATCTGGAATCAGATACATACATCGCAAAAAGTTACTAGAGACCTT
GGCAGATGAGTTGCCAAATGACACAATCCATTTCTCTTCAAAGATTGCTG
CAATTAATTCAGAAACACATGATGCTTTGTCCCCAGTTATCATTCATTTG
GCTGATGGTACTATAGTTAAAGCTAAGGTTTTGATTGGATGTGATGGGAT
ACACTCAACGGTGGCACGGTGGCTGGGACTTTCGGA
back to top