CF835334

Overview
NameCF835334
Unique NameCF835334
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length773
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_01B02_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01B02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835334 ID=CF835334|Name=CF835334|organism=Citrus sinensis|type=EST|length=773bp
GTTTGGTTATCTCTGTTAAAAGAAAGAAATTGTGAAGTAACTGCTTCCTT
TATCTTCCTCCTTTCTCATCGTCAGCAGTCACCACCTGCGGCGGCAGGAA
TTACAATTACAGATGGCGTTGCAAGAAAAGTTGGATAGATTCAAGAAGCA
GCAAGAGAAGTGCCAGGAAACCCTCAGCAACATTGCAGCCAAATCAGGAG
CTTCAAGGGCCACAACAACTTCAAGGCCTACACCTGCTGCAGCATCAACT
GCTGCAAGATCTTCTCCTCCTGTTAAATTTTCAAATGATACCGAGAGACT
TCAGCATATCAATAGCATCCGTAAATCTCCTGTGGGTGCTCAGATCAAGC
GTGTCATAGACCGGCTGCTGGAGACAAGGCAAGCCTTTACACCGGAAGAA
ATAAATAGAGATTGTTACGTTGATGTGAATGCTAATAAAGCTGTTTTTGA
CAGCTTGAGAAATAACCCAAAAGTGCACTATGATGGGAAGCGTTTTTCTT
ACAAGTCGAAGCATGATTTGAAGGACAAGAGTCAACTACTAGTCTTAGTG
CGTAAGTTTCCAGAAGGAATTGCTGTGATTGACCTGAAAGATTCATATCC
AACTGTGATGGAGGACTTACAGGCTTTAAAAGCTGCGGGTCAGATTTGGT
TGTTGTCAAACTTCGATTCACAGGAAGACATTGCCTACCCTAATGACCCC
AGGGTACCTATTAAGGCGGATGATGACCCTTAAACTTCTTTTTCGAGACA
TTGCATTACCTTCTGACATGCTG
back to top