CF835364

Overview
NameCF835364
Unique NameCF835364
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length796
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1101 contig Csv1_Contig1101:1..796. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01B23_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01B23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835364 ID=CF835364|Name=CF835364|organism=Citrus sinensis|type=EST|length=796bp
TTTTAGTAACAACTTCCTCATATAAAACTTCCGCATAAATAACAAGCAAA
ATGCACCAAAATAAGAAAACAAACAGAAGCAAACTAGCTGCCAGATAAAA
ATATATAAATTCCACATACGATATGACTACATAGATCCAATACGTCCTAA
TACCAATCAAAAATCAACAAGAGGTATACATACAAAAAACCATGGTTAAT
AACATATAGCAAAGCAAATAGTGAGAATTCGCCTAATTACATATAGCAAA
GCAAATAGTGAGAATTCGCCTAATTACTACTACATAGAGATGTTATGATC
TGATCTAGACTACATCAACGACCTAGAGGGTACTTTCCGTAATCATTGTC
CCTCCGGCTGTTCCTGAACGCACAGCAGCCAATGGAGTAAACGATGATAA
GCACTATGAGGAAGACAATGTTGACAATGGCAACCTTCTTCCAGTCACTC
TTGAGTTGGTCCAGCAGGCCAGCCTTGCATGATTGGCAGTTGTAGCACAA
AGTACTTGCATCATTCCCCCATGCACCACAGTCGGGATTGGTGCTAGATG
TGTTTCCCTTAGTCCATTGGGTTGGACCGGCATAATTAAATCCACAGTCA
TTAGATGGCTTGCAGCAACCAGACTGAACAGAAGACAAGTGCTCGGAATA
AAACTGCTCGACGGTGTCATTAAGATACTTATCATGAAAGCTTGAGCAAA
CTTTGCTATCAATCAAACAACTCTTAATCTTGTTCCAATTCTTAGTATTA
TTCACTCTCTTTTGCAACCAGTCTGAGTAATCTCCCAATCTGTACT
back to top