CF835365

Overview
NameCF835365
Unique NameCF835365
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length701
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12623 contig Csv1_Contig12623:128..827. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01B23_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01B23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835365 ID=CF835365|Name=CF835365|organism=Citrus sinensis|type=EST|length=701bp
TTGATTTTGAAAATCTTTGGCGCAATGTTTCGTCTAAGCAACAACTTGAT
CGGGCATCCTCAACATCTTAACATTCCTCCTCTCAATTCCGATCCTCTGG
GCCGGCATCTGGCTCTCCAACAAGGGCGTGACCGAATGCGAGAAGTTTCT
CGACAAGCCCGTGATAATTCTGGGCGTGTTCCTAATGATAGTCTCCTTGG
CCGGCCTCATCGGCGCGTGCTGCAGAGTCTCCTGGCTATTGTGGGTCTAC
TTGGTTGTGATGTTCTTGTTGATTGTGCTGTTGTTTTGCTTCACCATCAT
GGCCTTCGTCGTGACCAACAAAGGAGCCGGTGAGGTCTTGTCCGGAAGAG
GGTATAAGGAGTACAGATTGGGAGATTACTCAGACTGGTTGCAAAAGAGA
GTGAATAATACTAAGAATTGGAACAAGATTAAGAGTTGTTTGATTGATAG
CAAAGTTTGCTCAAGCTTTCATGATAAGTATCTTAATGACACCGTCGAGC
AGTTTTATTCCGAGCACTTGTCTTCTGTTCAGTCTGGTTGCTGCAAGCCA
TCTAATGACTGTGGATTTAATTATGCCGGTCCAACCCAATGGACTAAGGG
AAACACATCTAGCACCAATCCCGACTGTGGTGCATGGGGGAATGATGCAA
GTACTTTGTGCTACAACTGCCAATCATGCAAGGCTGGCCTGCTGGACCAA
C
back to top