CF835370

Overview
NameCF835370
Unique NameCF835370
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length779
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF835370_ssr141 microsatellite CF835370_ssr141:141..152. BLAST: Citrus ESTs to Prunus persica proteins V1
CF835370_ssr763 microsatellite CF835370_ssr763:763..774. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01C02_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835370 ID=CF835370|Name=CF835370|organism=Citrus sinensis|type=EST|length=779bp
AGGGCAGTCTTCATATACTTCCGAAGCAAGCACCGCAGCAGTCCGGTCAA
AACTTCAACATCCGACGGCCAGCGTCTTTTCCCGCCAAATTTACCTCCAT
CAGACGGCGGCCACAAAACTCCAACTGTCCAGCGCAATGTGTCGTCGTCG
TCGAACCAACCCAGCACGTCGTCAGAATTTCTATACCTGGGCACTCTCGT
AAACTCCCGTTCCGGAGAAATGCCTGTCGATACAAGAAACGCCGCCGTGA
AAATTGGCGTTTCAAAATCTCCGTCAGGGTATCACAAGCTCGGCTCGCCG
GAGCTGAATCCTCTGCCGCCGTTGCCGAAGCAAAATCCCAGTTTCACGAG
CGGGGAAATGTGTTTCAGCAAAGAAGATGATAATGAAGTGAAAAATATAA
CAACGGAAGAAGATGAAGATGATGAGGAAGAGGAGTTCTTTTCGCCGAGA
GGGTCGTCGGGTCGTAAAGAGAGTCGAGAAATCTCGACGCCGGCGCGTAT
TGGGTCGAGCTCAAGAAATTTTGGAAGCCGCAGCTTTAACTCGAGAACTG
CTTCGTACCCATATTCACATTCTTGCTCACCGACTAATTCCATCACCAGT
TCTTGTAACTCTGTGTCGAGAAATTCAAGTCCTAATCTGATGATGAAATC
GAGATTTCAAGAAAATGCTCATAACAAAAATAACTCGTCTGTTTCTTCAT
CGTCGAGAAGTGATTCTAGTGGTACCCTGAACTCGCCTGATCGAGCTGTT
CCTGTCAAACTTCCACCACCACCACCTCC
back to top