CF835574

Overview
NameCF835574
Unique NameCF835574
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length281
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_01I03_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01I03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835574 ID=CF835574; Name=CF835574; organism=Citrus sinensis; type=EST; length=281bp
TAAAAATTGGTTCCTATATTTTATGTTAGTGTTTGCTTTTGGCCAAATGT
TTCCTAGGTTGTCTTTGGAATGGATGAACATTTCCAGGGTTGAATTATGA
TGTATTTTCTATTTTTGTCACCTGAATGATATTTTGAATTTGTTGTTTTT
TGCGGAGCATGATTAATGTTATGTCAACTTAGGAGTTAAGGTTTATGGCC
AAGCCTTTTATTAACATTGTTTTGCATATTTTCCATAACTATTAGTGGGC
AATGTTAAGCGTATGAAAAAAAAAAAAAAAA
back to top