CF835706

Overview
NameCF835706
Unique NameCF835706
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length317
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig385 contig Csv1_Contig385:187..503. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUCRCS03_01L23_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01L23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835706 ID=CF835706|Name=CF835706|organism=Citrus sinensis|type=EST|length=317bp
TCGCAAACAACTCTTTTTCATTGAAAAGAAAAGAAGAGGAACAGAGTCAT
TTTCTTGGAAAATGTCAGGAGTTATTCACAAGATCGGAGAAGCCCTTCAC
ATGGGAGGAGGGCAAAAGGAGGAGGACCTGCACAAGGGAGAGCACCATAG
TGGGGACCACCACACTACTGATGTCCACCATCAGCAGCAGTATCACGGCG
GCGAACACAAGGAGGGCTTGGTGGACAAGATCAAGCAGCAGATCCCCGGT
GTCGGCACTACTGATGTTCACCGTCAGCAGCAGCATCACGGCGGGGAACA
CAAGGAGGGCGAACACA
back to top