CF835711

Overview
NameCF835711
Unique NameCF835711
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length741
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF835711_ssr485 microsatellite CF835711_ssr485:485..494. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01M02_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835711 ID=CF835711|Name=CF835711|organism=Citrus sinensis|type=EST|length=741bp
GTTAACTTCACTTTACATACACATCATCCCAATTTTACCAGACTACTACT
GTCAGAAAATATAGGTGCAATGGGCAGTTTTTAACAACTAAAGCGAAGAT
GTCTGTCGAAGGAGGTATACTCAAGAAAGAGCCAATTAGAGACAGTGATA
AGATTGGTCTTGAAATAAACGAGGCAAGGCCACATGATAAGCTCCCTTAC
AGAGGCGCTTGGTTGTGGGTGGGCGCTGAGATGATTCATTTAATGGAGCT
TCCAAATCCAGACCCTTTAAGCGGACGGCCCGAGCATGGTGGTCGAGATC
GTCACACATGTATTGCCATTCGAGATGTGTCTAAACTCAAAATGATCCTC
GACAAAGCTGGCATTTCTTACACACTCAGCAAATCTGGAAGGCCAGCTAT
CTTCACACGAGATCCAGATGCAAATGCTTTAGAATTTACACAAGTGGATG
GTTGATGACTGGCATCCTTGAGCCACAAAGTATGTATATATATAGTTGCT
AATGGCAAATGTACTGCAACTAGCTTATGGTGCACAGCTGCTATAGATTT
CCATACGAATGGATGCTGCAAGCAATGCATAGTCAAGAAATAACCAGAGA
TATCCTTTGTGCTAGTAAATAATCAATGGCTGAGTGTGGGATCAACCAGA
GGACGTCTATCACAAATGGAGGATGGTTTCAGNCAACTTGCTAAGCGAAC
CCGGAAACTGCTGATTACGCATTGAAAGGATACCAGGAATG
back to top