CF835716

Overview
NameCF835716
Unique NameCF835716
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length375
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:444..818. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01M05_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835716 ID=CF835716|Name=CF835716|organism=Citrus sinensis|type=EST|length=375bp
TTTTTGAACACAATAGTTTTATTTATTCTTTAAAGAAGACAAAGTACATG
AACGCAAACAAAGATAATCTCTTGTATAAGAGATTTTTGTAAGTGAACTG
AACTAAATTGACACTCTTATAATTGATAGATAATAACTGTACCCATCTTT
TTATTTAATTATATATATCATCATCCAGATTGCAGACACTTACCCATAAT
AATCAGGATTTCTCCCATATTGAGGAATAACAATAAGATCAAGATTGTCA
TTCCCAACATCATCATCAGCAATACTGGAAGGGGGGAGTAAGTAACCTTC
TGACGGATCGCTCATACCTGCGCCAGGAAGAGTTTTCATATTCTTCAAGT
CAGAAAAGATATTTGCTAGCTTCGA
back to top