CF835724

Overview
NameCF835724
Unique NameCF835724
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length116
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF835724_ssr22 microsatellite CF835724_ssr22:22..51.
Properties
Property NameValue
Genbank descriptionUCRCS03_01M09_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835724 ID=CF835724|Name=CF835724|organism=Citrus sinensis|type=EST|length=116bp
GTTTTTTTTTACCTTAAGAGCGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
ACCCTAAGAGAGAAGATAATAACTTGATTGCAAAGGAGACAGTAGGGAAG
AAAAAAAAAAAAAAAA
back to top