CF835729

Overview
NameCF835729
Unique NameCF835729
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length411
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:162..572. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS03_01M12_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835729 ID=CF835729|Name=CF835729|organism=Citrus sinensis|type=EST|length=411bp
ACTTTCATTCCCGTAAGCAGAGATCTTTCTGATTTGAAGAACATGGAAAC
CACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTGCTTCCTCCGTTTG
GCAGTATTGCTGATGATGATGTCATGAACGACAATCTTGATTTTCTTAAT
GTCCCCCAATATGGAAGAAACCCCGACTACATGGGTTAAGTGCAGCACTG
CTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAATGATAGGTATACTAT
TACCTATCAATCATGACAATGTTTTAGTATGGTTTAGTTCAACTTATAAG
ATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACTTTTGAGCTAAGTAT
TTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATTGTGTGTGTCAAAAA
AAAAAAAAAAA
back to top