CF835883

Overview
NameCF835883
Unique NameCF835883
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length673
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS03_02A23_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02A23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835883 ID=CF835883; Name=CF835883; organism=Citrus sinensis; type=EST; length=673bp
CTGATACTGGCCCGTACGACCTGGCTACAAAATTAAGAGCAACAATTGCC
CACAAACAGATGGAGAATGAAATGGGGCAGACAAATGGTAGTGGTGGAGA
CCTGTTTCGCCTAATGATAGGCGTTCTGAAGGACGATGTGATTGACATTG
ATGGATTGGTTTTCGATGAAAAATTGCCTGCATAAAACCTTTTTCCTCTA
CAGGCTGTTGAATTTAGCAGATTAGTTGGTTCTTTAAGGCCAGATGAATC
GGAAGATGCAATTGTGTCGGCCTGTCAGAAACTTATTGCTATCTTTCACC
AGCGTCCTGGACAGAAACAATTTTTTGTTACCCAGCATGGTTTGCTCCCT
CTAATGGAATTGCTTGAACTTCCTCAGACTCGTGTTATATGTTCTATTCT
TCAACTGATAAACCAGATTGTAAAAGATAACTCTGATTTCCAGGAAAATG
CTTGCCTTGTTGGTCTGATCCCTGTAGTGATGGGCTTTGCAGTACCTGAT
CGTCCCCGGGAAGTTCGTATGGAGGCAGCTTATTTTTTGCAGCAGCTTTG
CCAGTCAAGCTCCTTGACATTGCAAATGTTCATAGCTTGTCGTGGAATAC
CTGTTTTGGTGGGTTTTCTAGAGGCTGACTATGCAAAGTACAGGGGAAAT
GGTTCACCTAGCTATTGACGGAA
back to top