CF835894

Overview
NameCF835894
Unique NameCF835894
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length425
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B06_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835894 ID=CF835894; Name=CF835894; organism=Citrus sinensis; type=EST; length=425bp
CGAAAAAGCAACTTATACTACTTTCGAACTTTGATTCCCGTAAGCAGAGA
TCTTTCTGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGT
CAGAGGGTTGGTTTAATGTTTGGAACAGTATTGCTGATGATGATGTCATG
AACCACAATCTTGATTTTCTTAATGTCCCTCAATATGGAAGAAACCCCGA
CTACATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAA
TTAAATAAATGATAGGTATACTATTACCTATCAATCATGGCAATGTCTTA
GTCTGGTTTAGTTCAACTTATGAGATTTCTTGAGATGTACAAGATATCTT
TTTGAGCTAAGTATTTTCTTGAAAAACGAAATAAATCAATAAAAGTTATT
GTGTGTGTCAAAAAAAAAAAAAAAA
back to top