CF835901

Overview
NameCF835901
Unique NameCF835901
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length584
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B11_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835901 ID=CF835901; Name=CF835901; organism=Citrus sinensis; type=EST; length=584bp
GTTTTCTCAAGCCATAAAAAGAAAAATGGGTTCCAAATTGTTCCTTCTTT
TACGCCTTTTAATGGCCATTGCTCTTCTTATCTCTTCCGAGGTAGCAGCC
AGAGACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATAAGGC
CACAGAGACACATGAAATTGAGGACGGCCGTGGAGGTTATAACCGCGGTG
GCCGTGGAGGTTATAACGGCGGTGGCCGTGGTGGCTATGGAGGTGGTGGG
GGCTATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCGGTGG
CCACTGCCGCTACGGTTGCTGTGGACATGGTTATCATGGAGGCTGCAGGT
GCTGCACTTACGCTGGTGAGGCTGTTGATACGGAGCCTGAAACCGAGCCT
CAAAACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAAAT
AATCTTGCTTACATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTTT
TCTTTGTTTTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAAAAATACT
TCTTTTATATAAAAGAAGTATTTATGAATAAATG
back to top