CF835914

Overview
NameCF835914
Unique NameCF835914
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length712
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12419 contig Csv1_Contig12419:469..1184. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B20_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835914 ID=CF835914|Name=CF835914|organism=Citrus sinensis|type=EST|length=712bp
TTTTTTTTTTTTTTTTTAAAGAGAAGGCAATATTGTCTTCACTATCCCTT
AAGCATCATTTTGCCATATCCCTGGCTTTTACAATTGACGAATGAAAATT
TTAGATCCACTGCGCAAACATTCACTAGATGCTGTACCAAGATGTATCCA
AGGACAGACCTCAAAATATGTGTATGCAGATTACAAAAAGGGCGACTAAG
CAAGATAACAGTTTCTTTACAACTAAACTTTGTAATATTACTGACTGATT
TATGGCAATTGAGATTCACTGTTCTTTAATTGTAGTTCGCAAATTTCTTC
CATGTGAGCTAAAAGGAGCACTTTTAGCTTTGATAGGATGTCTGGATGAG
TCGGTGTCACCATTGCATTTCTTTGAGTAAGGCACTCTTGGATATGGATG
AATGGTGGCCAGTTCTCGGATTCGGCATAACACAGGCTTTGGTAAGCTAC
GCATGGCGTGCTTTGGGTCAACCTCTCCCTTGTTTTTCTGATGTGCATAG
CTAGCTCTTAGGAGATTACGCCATTTGTCCCTCAGATCTATGGGTGTGCG
GTGAGAAGATGATGAAAAGAGGAGTCTCTTTATGTCAGTCCATTTTCCAA
CTCCAAATTGAGAGATACCATCAATAAGCTTCATCACCTCAGAAAGAGTC
CACATCCTTTGATTCTTCCTCCGATCATCAATTTTAGATTTCCTCTTTCT
CACACGGTCATC
back to top