CF835916

Overview
NameCF835916
Unique NameCF835916
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length698
Alignments
Feature NameTypeLocationAnalysis
CF835916_ssr193 microsatellite CF835916_ssr193:193..207.
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B22_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B22, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835916 ID=CF835916|Name=CF835916|organism=Citrus sinensis|type=EST|length=698bp
TTTTTTTTTTTTTTTTTGGATCTTAAAATCATCAAATTACTAAACTGGGT
TTAGGGTTTAGTCTAACGTTATTACATTAAAACTTATATCAGAAACAAGA
GGGGGCAAACCAAGGTTTTCTAAAACCCCCATCATATTCAACCAACACTT
GACAAAAAGTGGCCTCTTCCTCTTTTTGCATGCATCATCATCTCATCATC
ATCATCACTTCTATTAGTTTTCATTTTTTGGTCCACCGGCAGGCATTAAA
TTCTCTGGCAGCGTCTGCAAGGCTGGCCTTGGCACTTGTTTCTTGATGGT
GTTGTTTTTTTCTTCATTGTTCTTTTTGGTGGTGTATATCTGCAGTTTCT
CCTTGAGCATCTTGGTTAGCTGTCTTAAACTCTTGTCATTGAGTGATTTT
GGCTTGCTATCATCTTCACCAATGTTAATGTTGTTCCTTTTCTTCTTTAC
CTTATCCTTCTTGTTAGACTCCTCATCTTTCATGATCAAGACCATGCCAC
TGCTGTCAATGTTCTCCTTATTGTCTGCTTGAATAAAGGCTGCCAGCTTC
TGATTTGACGCCTCTGACTGATTTGGTGCGGGGCCAGAAGAATCGCAACA
ATTACATTGTTTGGCAATGGCCGCTGGTGATGATGCCATGGCAAATTCTT
TAGATGAGAACATAACATGGATGTCACGCGACTTTTTCATGCTGTTGC
back to top