CF835918

Overview
NameCF835918
Unique NameCF835918
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length402
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5486 contig Csv1_Contig5486:496..897. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B24_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835918 ID=CF835918|Name=CF835918|organism=Citrus sinensis|type=EST|length=402bp
TTTTTTTTTTTTTTTTTAATGAACATAATACTCATCATTCAACATAACAA
GAAACTACAAACGGTTCATATGGTTCCAAAATTCAAGGCTTTATAAGTAA
ATAATTTGCCATTAAACAGAAAACAAAATAACTTGGGAAACAAACTCCTA
CAAAGAAACCAGAACCAACATTAACATATATAAGTTATCAATCTTCAGTC
TCCATCATCGATGTATCAGCGATCACTTCTTAGCTTTCTTAGCTCCCTCA
GCTGGTTGGGGTGCTGGTACTGCCTTCTCTCCAGGTCCCTGGGCTAGTCG
CTCTTCTCTCCTGGCCAGCTTTCTCTCCCTGCTGGCCTTGTTCTTGGCGC
GCTTAGCCTCAAACTGGTCAGAAAGAGTCTTCTCTCTTGCCTTTTCAGCC
CT
back to top