CF835921

Overview
NameCF835921
Unique NameCF835921
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length774
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF835921_ssr20 microsatellite CF835921_ssr20:20..31. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig11851 contig Csv1_Contig11851:1114..1887. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02C01_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835921 ID=CF835921|Name=CF835921|organism=Citrus sinensis|type=EST|length=774bp
TTTTTTTTAGTCACTCTCAAATAATAATAATTAAAAGTTAAAAAAAAAAA
AATTTAACAATGTTCTATGAGAGGTCTGCTATATATATCACAAACAAAAG
AACCCACTCAGCCGGAAAAAGACACATTCTGTTGATAACTTTACATGGTA
TTGTATACCTCCAGTTAAGGGGAAAACTGCACATAATGGTTAACTAGTCT
CAGAAGGTGGTTAAGTGTTTTTTTCTAAAACAGATAGTGCTGGTGTCAAA
TAATTATTTGCTTTATCAGGCAAATGTGCAACCAGCTCATACAGCTCCTT
CCCTTGCTCAGAAACATACTCATAACATACATCAAAGCTTTTGTTCCTTG
CAGTTGAATCATGCAATGCCTTAACACAGATATCGGCCACATCAGCACAG
CTGATGCCCTGTGTAATCCTGTTTCCTTGATCAAAAATTAAAGCACGCTG
GCCACCAGGTTCCTCCTTAAGGGGACCGGGGCGAATGATTGTATACCCAA
GGCCTGATCGTCTCAATGAATCTTCGCCATCCCTCTTGGCTTTAAGAACC
TGCTCCCTTCTGCTAGGTTCTACCCCTAATCCTGTGCAAGACACTAAGAC
GAAGTCTGTTTCTTGCCCAGTAGGCAAGGCTTTTATATACTCCAATATAA
GCTTAAAGCTTCTTAGGTCTTGCTTTGCTCCAGAAGGTCCCTNCACAGGT
CTCTGTCGTCTGGGCTCAAATCGGATTGTCATTGTGTGTACAAGGAAAGG
ATCCATTGGTGGATCATCTGGTTT
back to top