CF835924

Overview
NameCF835924
Unique NameCF835924
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length416
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:158..574. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02C04_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835924 ID=CF835924|Name=CF835924|organism=Citrus sinensis|type=EST|length=416bp
CGAACTTTGATCTCCCTTAAGCAGAGATCTTTCTGATTTGAAGAACATGG
AAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTGCTTCCTCCG
TTTGGCAGTATTGCTGATGATGATGTCATGAACGACAATCTTGATTTTCT
TAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGGTTAAGTGCAGC
ACTGCTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAATGATAGGTATAC
TATTACCTATCAATCATGACAATGTTTTAGTATGGTTTAGTTCAACTTAT
AAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACTTTTGAGCTAAG
TATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATTGTGTGTGTCAA
CAAAAAAAAAAAAAAA
back to top