CF836229

Overview
NameCF836229
Unique NameCF836229
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length670
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF836229_ssr187 microsatellite CF836229_ssr187:187..198. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig224 contig Csv1_Contig224:11..680. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_02K01_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02K01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF836229 ID=CF836229; Name=CF836229; organism=Citrus sinensis; type=EST; length=670bp
AAAAACTACTCACAAAAATGAACTCCTTCGCTAGCTCTGTCTTTGTCATC
TTGCTCATCACATCAACTTCGTCACTTTGCGTGGCTGCCCGACCCGGAGC
ATCAGCTGAGCTCAACAACGACGACAAGCTCTCTGAAGGCAAAACCACCA
ACCAAAACACCAAGGGTGGAAACGGGTATGACGCCGGGATGGATGGATTC
TTTGGACCCGGATCAGGTATACCCGGGTTCGGAAATGGGATAGTAGGTGG
CGGGTATGGAGCCGGGTACGGAGGTCCGAATGGAGGGTACTCAAGAGGTG
GTGTAATTAGGCCTAGTGTGGTGTGTAAGGAGAGAGGTCCTTGTTACATG
AAGAAACTGACGTGTCCGAAAAAGTGCTTCACCTCTTACAGCCGTTCAGG
GAAGGGCTACGGCGGTGGTGGCGGAGGCGGTGGATGCACCATGGATTGTA
AGAAGAAATGTGTCGCTTACTGTTAGAGAATGAGCTGAGCCCTGGTCTTA
GTTTCTAATATTTCTTACGTAATGTAATCTACTGTTATATTCATATATAA
GTCATGTATGTGCTGCAAGGTTTATTATGGGTTGCCTTGTGGCTTGAGCC
CCCTTTTTTCTTTTTCTTTTTCTCCTTCTTCGGNTGAGCTACTACTTATA
ATATAATATATATGGAGATA
back to top