CF838922

Overview
NameCF838922
Unique NameCF838922
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length802
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS03_06P23_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa06P23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF838922 ID=CF838922; Name=CF838922; organism=Citrus sinensis; type=EST; length=802bp
GTCACCACCATCATTTACTTCTCTCCTTTTCTCTCTCTATCTCTCGCTCT
TCCGCTGTTTATCTTTATCCTTCAAAAAAATAATTCAAAAAAGCAGCGAC
ATTTAAAATATTTATCTTCAAAACGATGTCGTCGCCTTAGTAATTTGTTT
TAAGACTGACACATTCCTTATATGGAAAACACATGGATTCCCAACATTTG
AACTTCGAACTTAGAGAAGCATCTTGATCTTGGGATCATTATCTGCATTC
CTTCCAATAGCGTGAGTCTAAGATGGATGACGGGCATCATGAAAATGGCA
GATATAAGATGGAATACTACAAAGGGACGCATGCTCAGTGGAATATGATG
CCGCAGCATCAAATGAAGGAACCAAATAATGCCTTAGTAATGAATAAGAA
GATCATGGCCATCCTTGCGGAGAGGGATGCTGCTATTAGAGAGCGAAACA
TAGCATTGACTGAAAAGAGGGAAGCATTGGAAACCCGAGATCAGGCGCTT
GAGGAGCGCGATAAAGCCCTTGCTGAGCGTGATGATGCCTTGATGGCACG
AGACAGTGCCTTGGCAGCATTGCAATATCGTGAAGCTGCTGCCAACTTCT
CCTCAGTTGGTGGATTTCAACGTGGAGGAAAGCGTATGCACCACCCCACA
TACCAGTCTGGTGATGTTCCGGAAGCTCTTAATTCGGGGGATATGCATGC
AACTGATGCCAAGCCAATAACAATCATTCCTTCTGAAACCAAGCCACATC
AAGCAAAGCGAGCAAAAGAGAACAAAATAGTTACAAAGCCATCTGTGTCC
CC
back to top