CK740109

Overview
NameCK740109
Unique NameCK740109
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length342
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6603 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65E08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740109 ID=CK740109|Name=CK740109|organism=Citrus sinensis|type=EST|length=342bp
ACAAAACATTATGCATTTATTGATGTCCGTTCAATGTTTAATACTTTATA
CCATGGTAGATTTATGTCCCCATAAATTGTGATGGTCATTGGTACATGCT
TCTTGTTGACATTTCTCATGCAACTGTAACTATTTGGGATTCATTGGAAT
CGCCGAGTCGAAGAGAGAAAATGATTAATGAGTCTTTGGCATTTGTATGT
TCTTAAAATCATTGACTATATTTGCGTATATTTCACACTTGAATGTTTTA
AATCTTGCAATACTTATTGCTTGTTGATGTTGGCAGCTTGCCTCCCTGGA
TTTTGGTCTCCGTCAAGAGGCTAGAGCTCTTTTTGGTAATCC
back to top