CK740120

Overview
NameCK740120
Unique NameCK740120
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length542
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6614 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65F07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740120 ID=CK740120|Name=CK740120|organism=Citrus sinensis|type=EST|length=542bp
GCGACCTTCAAAGGGTGAACCTATTTGAACTGTCGCCAGATGAGAAGTTG
GCCTTCTTCTTGAACTTATACAATGCGATGGTCATCCACGCGATAATTAG
AGTAGGCCATCCGGGAAGGAGTAATCGATCGAAAATCCTTCTTTTCAGAT
TTTCAATATGTAGTCGGAGGCTATCCTTACTCCCTGTCTACAATAAAGAA
TGGGATCCTGAGAAACAATCGCAGAGATACCTACTCGTTGGCCAAACCCT
TTGGCTCTGGCGACAAGCGCCTGGAGCTCTGTCCTCTGAAAGTGAATCCA
CTGATCCATTTCGGGTTATGCAATGGAACAAGGTCGAGTCCCACAGTGAG
GTTTTTCTCAGCTCAAGGAGTTGAAGCCGAACTGAGATCTGCCACCAGGG
AGTTCTTCCAGAGTGGTGGAATGGAGGTGAATTTGGAAAAGAGGACAGTT
TTTCTCACAAGGATCATTAAGTGGTTCAATGTAGATTTTGGACAGGAAAA
AGAAATATTGAAGTGGAGCATCAATTATCTGGATGCACAAAA
back to top