CK740121

Overview
NameCK740121
Unique NameCK740121
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length638
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6615 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65F08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740121 ID=CK740121|Name=CK740121|organism=Citrus sinensis|type=EST|length=638bp
CAAAATTAAATATCCCAAAAAGATTAATTAGTCATTGATTATCATGGCTC
TCAAAAATGTGTGTCTCATTTTGGTTGTAACGGTTATGCCTCATGGCATA
TGCAACCACTGCAACTAGGACTAGCTATGACCACAAGGTCAATACCCCAG
GTTATGATCTTGCCGCAAGGCTTCAAGCTTACCAAGGCCAATTTATGGAG
TGCTGGAATTCACTTCAGAAGTTGACTTCTTGCTCAAGCCTGACCGTCCA
ATTCTTCCTCACTGGCAAGGCTGATATAGCTTCCTGTTGCGGTTCCATTG
ATATCATCTGCAGTAAGTGCACCTGGCCATCTGCGGTCACTTCACTCGGA
TACACACCCGCCGAAGCCAACATACTTAAAACTTACTGTGATGCAGTTTC
TGCTCCACCTGCAAACCGTAAACCTTAAGGCAACATGCTCGCTCTAATTA
TTGCTTCTTCAATTTTAAGAGTACTCTTGTTTTGTTCTTTGGGGGTGTGG
CCTCGTGCATTGACTCAATTTCTCTTTTATGTTGTTGCATGGACAAGTGT
TGTGTTAAAGATTTAGCTGTCCAAATAAATTAAACTACCCTGCTGGTATG
TTTTATGGAATAAAGCATTTCATTTAAATCTAAAAAAA
back to top