CK740123

Overview
NameCK740123
Unique NameCK740123
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length629
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6617 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65F11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740123 ID=CK740123|Name=CK740123|organism=Citrus sinensis|type=EST|length=629bp
CACGGAGGCACCTCCCGGTGTTAGTAAGTTTGGGCGTCCGTACCGACCGT
CGTATATATTTGGCAGTCCTTACTTTATTCCTCCTTTCAAGAGAGTTAGG
AATGTCAGGGCTTTACCCGCACTCAACATTACGGACTATGAAATTGATGA
AAGATCGAGTGTGGATATGAATCCGCTTAGGGGACTAGAAGACTCAAGAC
TATGTGAGGAGTTTGATCAGTGGTTTGCCGGCAACATTTCCGTGGATCGA
CTCGTCCAACAGTCTCGAAATTTCTTTGAAATACTCATGGGCAATGCTTC
GATGAGGTGGCTTGGTGACGAAGTAAGCGTGTTTAATGCATATTCACACG
TATTACCGCTTGATCAGCGAGAAGCAACTGCGGTTTCCAAATGCACTACC
ACAACGCGTCACGCATACAGATACATACTTTTGGGCTTGTTTTCAAATTT
TATAATCATTAATTATAATTTCGATGTTTTAAATATCTCGAAATGTTATT
AATTTTCTACTCATCGTGTAATAGGTGGTTCTAAAGCAATTATGGAATAA
TGGGAGGTGGGATGTCAATTCATTACAATATGGCAACCACTTGAGCAGCT
ATATGGATGGGCAGGAAGATCTCATGTCC
back to top