CK740132

Overview
NameCK740132
Unique NameCK740132
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length530
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1440 contig Csv1_Contig1440:1..531. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6626 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65G11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740132 ID=CK740132|Name=CK740132|organism=Citrus sinensis|type=EST|length=530bp
AATCAACTCATACACACAATAATTTTATTTATTAATTAAGGACGACAAAT
ACATGTGCTAAAGAAAGCAGTTTTTTGTCTATCCCACAAGATCTTAGTAG
TTGACTAAACCAACCTTGTATTCACATCATTGATGGATAATAACATTATC
CATCCTTTTATTTAACTAAACATAATATAAAAGTATAATGCTGTAACACC
TAACCAGGGTAGTCAGGGTACCTCCCGTATTGAGGGACAGTGAGAAGATC
AGGATCATTGTTATTTATTTTCTCATCATCAAACATGCTAACTCCTATAT
TAACCTGCTGACCCTCTGACCATTCTTTGTTACCTGTGTAAGGAGTTTCC
ATTTTCTTCAAAGCAAAAACGATCTCTGTTAGCTTCTGGAGAACCGTAAT
CAAAAGTGAGCCTCGTGCCGAATTCGGCACGAGGCTTACTGCTTCAATTC
TTCACCAATTGAAAGAAGCAAAGTTTCTGAAACCTGATTTAGTGAAAAAT
GGCACAAGCTATGGCGTCAATGGCTGGCTT
back to top