CK740313

Overview
NameCK740313
Unique NameCK740313
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length266
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1655 contig Csv1_Contig1655:591..855. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6457 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE63G04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740313 ID=CK740313|Name=CK740313|organism=Citrus sinensis|type=EST|length=266bp
GGTTCGTGCATGTTCGAGTTCTGTGTCGGATATTTCCGGCGAAAAGGCGG
CGGCTGTGGCCTGATTCCAAGGCGGAGGGTATTTTTGCGATTTGGTGTAG
GAGGCTGGGGCTGAATGGTAATAATAGTAATTGTAATTCGGTTGTTGTTG
TCTCTTTGGCGAGTCGGGCGCTGGGGTTGTTTTTGGAAAGGACGACGGCG
TTGCCCTTACGGGCTTGCTTGGCGGCATCGTTTTGGTTTGGTCTGAGAAT
GTGCGGGGACAAAACG
back to top