CK740314

Overview
NameCK740314
Unique NameCK740314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length508
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK740314_ssr115 microsatellite CK740314_ssr115:115..126. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6458 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE63G05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740314 ID=CK740314|Name=CK740314|organism=Citrus sinensis|type=EST|length=508bp
AACCAACCCAGCTTATTAATTCATAAAACAATTCAACTCCTTTCCCACAT
TTCCCTTCTTTCATCCAAAGAGCCAAAAATATTCAAAGAGCCCAAAATAG
AAAGATAGAAAGATAGAAAGAAAGAAACCATGGATACTGAAAATCAAGGG
GAGCAATATTACCAAAAACAAGAGAGCTTGAGTCAGTTCATAAACTCCCA
GTTTCTGAGGAAAGCTGTTACCAAATTAATAGTATCAGTTTCAGTATTTT
CCCTTTTCTTTTCTCACACAACCTTGATCTCTTTTCTCCATTATTTCAAA
TTCTACTTCTCAACTTTACCCTTGAAATTGTTCAGCCACACTTTGGACAA
AAACTGCACATTCCTTCTTTGTAATGGCCTCTTAGTTTTTTTGGCAAAGT
ACTCTGGCTTATTATCTGTATCATCATCACCATCACCATCAAATAATAAC
AAGTCTAATCTTACGGGTGATCATCATGAGTCTTTCAAGAACTATGAAGA
TGATCCCG
back to top