CK740316

Overview
NameCK740316
Unique NameCK740316
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length405
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK740316_ssr89 microsatellite CK740316_ssr89:89..104. BLAST: Citrus ESTs to Prunus persica proteins V1
CK740316_ssr257 microsatellite CK740316_ssr257:257..268. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1450 contig Csv1_Contig1450:1..405. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6460 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE63G07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740316 ID=CK740316|Name=CK740316|organism=Citrus sinensis|type=EST|length=405bp
AGTTTTGAGGTTGTATAATATTTGCAAAAATAATTCGCACACGTGATTCC
ACTCAAATTCAATTCAACACACAGTGTCTTGATTTGAACTCTCTCTCTCT
CTCTTTCTCATGTCCTTACCAAACGATGATAATATGTCCGCTCATTCTCA
GCTTTCGTCTCATTTTTTTGAGGACTTATTGGATTCGATAATTGGTGATG
TTGCATCTGAGTGTCACCGGGTAGCTAGGGTGGGGCTTGATCGAAATTTT
GAGGAAGAGGAGGAGGAGTTGAGGTTGTCAGCGCAAGCTCGCGCCAGGGT
AGCTGATTCGAGTAATAATGGTGAAACTAATAGCAAGTATGTTGCTGATA
TCTTTGGACAAACTCATCCTGCTGTTGCCAATGAAATTTTTGAATGCATG
AACTG
back to top