CK933027

Overview
NameCK933027
Unique NameCK933027
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length492
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12654 contig Csv1_Contig12654:27..518. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit juice sac at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004348_F08 Developing fruit juice sac at 38 DAFB Citrus sinensis cDNA clone JSJune0004_IIF_F08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933027 ID=CK933027|Name=CK933027|organism=Citrus sinensis|type=EST|length=492bp
GGGGATCCACGAAGTTCTTGAGAGATAGGGAGAAATATGGCTCCAACAAT
GGCTGTGAGGGAAGAAGAAGTTGTTCTAAGAAAGAGAAATGAAGATCTGG
AAAGGGAATTGAAAAAGAGCAAAGAAAGAGAGGACCAAATGAGGTTGGAG
CTACAACGGGCATGTGAGAGACTGCGCTTGGCTGAGGACGCCGAGGAGAG
ACTCTGTTCACAGCTGGGCGAGCTCGAGGCCGAGGCCGTCAATCAGGCGC
GTGACTACCACGCTCGCATTCTTTCCCTCGTGGACCAGCTCTCCCAAGCT
CACCAACTCCTCCTCCACCACCTCCACATCACCACCACCGCCACGGCCAC
GGTCACAGCCACACAGTTTTAGCCTTTTTAAATACTTTTATTATTATTTT
ATGTAATTGTCGTTGTATCAGCAGCTTTTTAATTAGCAGTTCAAAGGCTC
AATCATGTGTACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top