CK933028

Overview
NameCK933028
Unique NameCK933028
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length226
Alignments
Feature NameTypeLocationAnalysis
CK933028_ssr12 microsatellite CK933028_ssr12:12..26.
Libraries
Library NameType
Developing fruit juice sac at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004348_F09 Developing fruit juice sac at 38 DAFB Citrus sinensis cDNA clone JSJune0004_IIF_F09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933028 ID=CK933028|Name=CK933028|organism=Citrus sinensis|type=EST|length=226bp
TTTTTTTTTTCTTATTTTATTTTATTTTACTTCCAGCTCTCTTTGTGCTT
TCTTCTAGGTTGTTGGAAAACAGGATGCTTTGATTTTTGTAGAAAGTATT
ACATTTTTTTGTTCCCATTAGTTTGTTTTAATGTTGAAATGACTTGAATG
TTTCTCTGTGTAATCTGTTTATTTTAAATAAACCGTTCGGTCAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAACATG
back to top