CK933039

Overview
NameCK933039
Unique NameCK933039
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length403
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK933039_ssr134 microsatellite CK933039_ssr134:134..145. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig6379 contig Csv1_Contig6379:20..422. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit juice sac at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004348_C11 Developing fruit juice sac at 38 DAFB Citrus sinensis cDNA clone JSJune0004_IIF_C11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933039 ID=CK933039|Name=CK933039|organism=Citrus sinensis|type=EST|length=403bp
GCGGGGGCTTCAAATCACCTTACTCGCTNNNAAAGCTCCCTCACCAANCN
NNAGAAAGCAGCGATGGCGATAATCTCCGATTTCCAAGAAGACGAGAACA
AGCCTGACCCCAAGAAGAACCCATCGGCTTCCGCTTCTTCTTCTTCGCCA
TCATCGGCTAAGACGTCGTCGTTTAGCGCGACATTGGATCCGTCGAATCC
GCTAGGGTTTCTGGAGAAGGCGTTCGAGTTTGTGGCTAAAGAGAGCGATT
TCCTGACGAAGGACGCTGCCGAGAAGCAGATCGTGGCGGCCATGCGAGCG
GCCAAGGAGAAGAGTAGTAATACTAAGAAGCAGCCGCAGCCCCAGTCGCC
GCACCAGGAGGAGGTTAAGGCTAAGAAAAAAAAAAAAAAAAAAAAAAAAA
AAA
back to top