CK934134

Overview
NameCK934134
Unique NameCK934134
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length453
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10409 contig Csv1_Contig10409:1..449. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCGF1004541_A04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_A04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934134 ID=CK934134; Name=CK934134; organism=Citrus sinensis; type=EST; length=453bp
GGGGAAGCAAAAATACTCACAATTGAATACTCCTGAAGATAGCAGTAGCA
GAGATCTTTTCTGATTTGAAGAATATGGAAACTCCTCCTTGCGCAGGTAA
TGCGTGGTTAGAGGTTATTGTCCCTTATCCGCCAGGTTCTAGTATTGTTG
ATAGTGAGATTGCAACTGAAAATCTTGAACTTATTGTTGTCCCACAAAAT
GGGAGAAATCCTAATTATACTGGTTAAGTAATGAATATAGTATTACTCTT
TATGTTTTATTTGATTAAATAAAAGGATAAATATTATCCATTTGGTTTAG
TTCTATTACAAAGATCTCTTGTACAAGAGATTATCTTTGTTTGTATCCAT
GTACTTGTCCAATCATGATAGTTAAATGAAATTATCATGTGATAATATAA
GATAAAATCGTCTGCTTAGGCCTCAAAAAAAAAAAAAAAAAAAAAAAAAA
AAA
back to top