CK934425

Overview
NameCK934425
Unique NameCK934425
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length319
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCGF1004259_C04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IIF_C04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934425 ID=CK934425|Name=CK934425|organism=Citrus sinensis|type=EST|length=319bp
GGGGAGGGTTCGGTTTCAATATCGGACTACTTTACTTTCTTTTAACTCGG
CTTTACTGAACTCACCAAACGATTATCAAACTTAGCTCGTAAACCTTGGG
GTCGATCCCCGATCCAGGCGAGTTAAGTGAGTTGAATCCGCTGAGTTTCG
ACGAGTTCCAGCGCCAGACCTCGTTGATGACCAGCTGCACAGCTCCTCTG
GAAAGAGCTCTCCGATCACTTCACTTCTCTCGAGCAAAACCTCCAGAAGA
AATCAGCTGCGCTCAGGCACAAAATCCAAACCCTGGACACTCAGACGAAA
GCGTCATTGGACGTTCTAA
back to top