CK934440

Overview
NameCK934440
Unique NameCK934440
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length690
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004259_A04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IIF_A04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934440 ID=CK934440|Name=CK934440|organism=Citrus sinensis|type=EST|length=690bp
GGGATGGGAAGAGGAGACGGCTACCATCAGAGTGACAGAGTCACGCTGTT
CATTCTTCAGTGGCATGTCATACAAAACCTCATATTCTCTATATCTTACT
GTATTGCTCTTGGGTTGCTGCAATGCTTCTACCTATCGCTTTTCCTGGTT
ACTGTGGCCTAAATGCACAGGGGTTTCTTGAGGGAAAAGGAGTGGAGTAA
CAACCCTCTGTTTTCATGAATTGATGAGCCTCAAGGAAGATGTGTTTGAT
GGGCTGCATTCATTCGCTTTCTCAAATATTGGCTTTGGTCTGTCAAGNNN
GCAAACAAGCCTTGATAATTTTGGCTTTCACTTTTTCCCCCCCTCGAGCG
GCCCTTAAGAATGTGTAAACTGCTCTCCTGGAAGAAAATGCCTAGAAATA
GTTGAAGCCATGAAATTGTCAAAAAATGGAAAGGATTTTGTTTAATAGGT
TTATATACCATTTTGTAAAGCATCATCTCATGTTTTGTAAAATTGAGTTA
CATGTATTAGGTCCATAGAATGTAAAGGCCTCTTTCATTATTTATTTGAC
TATTTGTGGCTCGCTGTGAGCTTGTAACACTCTTGTACTGACTTTGAGGC
ACACTTGTATTTACATTTGATGCACTGTAACTGATTTAGGATAGTCAGTG
ATGAGCTTTTACTAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top