CK935183

Overview
NameCK935183
Unique NameCK935183
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_H03 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_H03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935183 ID=CK935183|Name=CK935183|organism=Citrus sinensis|type=EST|length=370bp
GGGTAGTAGGACATTTAGTCAAATAATTATGATTAACTTTTAGTAATTTA
GTCTTTTCTTCGGGAAAAGTAGGAGAAAAGACCGCGAAATTCAATCTTGC
TTTTTGTTCTAGAAAAGCAAAGGTAAATTGATCGAACAGAACAATGAGGA
TCTAAATCAGTTTTAAAATTGTCTTTTGGCTTGGTCTAAAGATAGGACTA
GAAGATACGGTAAAAAGTAAGATAATGGGACAATTATGTATTAAAAGCCA
AAAAAAAATAAAAATGATCTATTATAATCTATTTCCAGCCGAAGATAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAA
AAAAAAACTAAAAAAAAAAA
back to top