CK935204

Overview
NameCK935204
Unique NameCK935204
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length469
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig358 contig Csv1_Contig358:8..477. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_F05 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_F05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935204 ID=CK935204|Name=CK935204|organism=Citrus sinensis|type=EST|length=469bp
GGGGAGGAGAAGGAAAATCAAAACAGAGAGAAAATGGCGATAATGAGAGG
CGAGCCACTGGTGGCGAAGCTGGCTGCTTTAGCTAAGTACGTGATTTTAC
CGGGATCTATGGCTGCTGCTTTAATCTATTCGCCTCCCCAATATGGATCC
TCCACCAAGTCCCAGAAATCTCCTAAATAGGGGCATTTTGAACGCTTTGC
TCTGTAATTGCAGATGGTGGGCAATGTTATAATTTCAGCGGCCAAAAATA
ATTGCTGGATATGTTTTGCAGGCATTTGTACTTCAGTGTTTGTTGCATTC
TGATGAAGAACTCGTGTTGGGAATCTTCTTTATGAATAGACCTTGTTGGA
AATAAACTGTTACTCAATTGGTTCAAGAAGGTCCTGTTGCTCAATTGTGA
ATCTTCTTTATTAATTAAATTGATCGCACATCAGTGCTTCAAAAAAAAAA
AAAAAAAAAAAAAAAAAAA
back to top