CK935215

Overview
NameCK935215
Unique NameCK935215
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length882
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1777 contig Csv1_Contig1777:1..885. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_E12 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_E12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935215 ID=CK935215|Name=CK935215|organism=Citrus sinensis|type=EST|length=882bp
GGGGGGGTCGAATTGCTCGTCAGTATTGCTCATGATGGAAGACCAAGAGG
AAAAGGGCAACGCTGAAAATGGGATTGGAAGGCAAAAGCAAGTCAAAGGT
GAGTACTTGTTGCAGTTTTTGGATTCATTGGATGGGTATTTAACTCTATT
AGATTCTTTATCTTCGACCCTTAGCCAGGGGTGGCTGGAATTGGCAAGCG
CCAGGCATGCAATGGGAGCTTCACGCATTAATGGCGCTTTGTTAGATCTT
AAAGTTCACGCCGCTGCTACTTCACTGAAAGTATCTGAACAAGATGTTGA
TTCCATGGAGTCGCAACCTTGCTTTACTTTATGCAAATGGGCATCCTCTG
ATAATGGAGAACGTTCTTCCGGAGAAGAGAAATCTCTAAGTCCACAGCTA
CGACACCGGAACAATTCCCAGCTCTCTGAAGAGAAAGTCTCAACAAGGAC
TGGAACTCCACTTATTCTTGTTGACCAACAGCGGCAAAAATCATTGTCAG
TGTTCGGAGTACTGGTCTCCCCAAAGCTTCGATCTGCACAATTATCATTT
GAGAGAGCTCTGGAGACACTTGTAGAAATAGCAGATTTGCACACAACAAT
GCTTTCTATGTTTGAACAAGTCCACAAAGAATTAGAAAACACCAATGGAT
GATAACAAGTTTCTTCCTTTTGGTTGGTTATTTTGCATCGGAAGACATGA
TTGATTGCATTCAGGCAAAGTCCTACAGATAGCGACAGATGATATTCGTT
GGGCTTTTTCCCTACAATTGTGACTTAAAAGCTATTTCCTTTAACCTGTT
ATGTTGGCTTCTTGCTCATCGTATGTCTATCATCTTGATCTATATGATTA
AGTTTTCTTTGATCCAGCAATTTTTTTCTTGA
back to top